Electronic excitations in G-quadruplexes formed by the human telomeric sequence: A time-resolved fluorescence study

Abstract The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K⁺ cations, noted Tel21/K⁺. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K⁺ is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects. G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K⁺ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.